STRAND A
Molecular
Diagnostics
Highly specific, affordable, and rapid detection of pathogens and antimicrobial resistance (AMR) using CRISPR, RPA, and microfluidics.
CRISPRRPAMicrofluidicsAMR
Molecular Diagnostics × AI Drug Discovery
Engineering the future of biotechnology.
Advancing molecular detection and accelerating small-molecule drug discovery through AI, precision diagnostics, and intelligent platforms.
CRISPR detection//
Isothermal RPA//
Multiplex qPCR//
Microfluidics//
Multi-objective optimization//
Potency prediction//
ADMET models//
MCP design agents//
CRISPR detection//
Isothermal RPA//
Multiplex qPCR//
Microfluidics//
Multi-objective optimization//
Potency prediction//
ADMET models//
MCP design agents//
01 — What we do
We bridge the gap between AI computation and wet-lab validation.
Two core pillars. Two strands of one helix.
Molecular
STRAND B
Drug
Discovery
Shortening the path from target to validated small-molecule assets using multi-objective optimization, ADMET prediction, and Language-Model Agents.
Multi-objectiveADMETLM AgentsMCP
02 — About us
Translating molecular science and AI into practical healthcare solutions.
Thinkhat Labs is an innovation company built on molecular science and advanced computation. Whether we are identifying the genetic markers of a resistant superbug or designing a novel small-molecule inhibitor for breast cancer, our approach is the same.
01
Start with the biology
02
Design computationally
03
Test rigorously in the laboratory
03 — Drug discovery
Computational design, prioritized for potency, delivered as validated small-molecule assets.
Thinkhat Labs operates an AI-enabled drug discovery platform that massively accelerates the journey from biological target to validated drug candidate. Our frameworks allow medicinal chemistry hypotheses to be generated, scored, and ranked at an unprecedented scale.
GENERATED
SCORED
RANKED
THE PLATFORM
P.01
Multi-Objective Optimization
Evaluates candidates against multiple design objectives simultaneously for a perfectly balanced profile.
P.02
Potency Prediction
Estimates biological activity against the target to prioritize the best candidates before synthesis.
P.03
ADMET Models
Predicts absorption, distribution, metabolism, excretion, and toxicity early to deprioritize unfavorable compounds.
P.04
MCP Server & Design Agents
Exposes our scoring models through a Model Context Protocol (MCP). Language-model agents use this to propose and iterate on new molecules in a controlled, auditable workflow.
design-agent · auditable loop
# illustrative agent workflow
agent.propose(scaffold)
mcp.score → potency · ADMET · objectives
agent.iterate(ranked)
↳ every step logged for review
›
04 — Diagnostic technologies
From established reference methods to programmable sequence sensors.
LIVE VIEW · CRISPR-BASED DETECTION
Cas enzyme + guide scanning target
ATGCGTACCTAGGCTAACGT
Target recognized → highly specific fluorescent or lateral-flow signal.
Quantitative, cycle-by-cycle detection — multiple targets in a single run.
37–42 °C
Rapid DNA amplification without thermal cycling — ideal for point-of-need testing.
Sample prep, amplification, and detection in a single automated format.
05 — Pipeline & applications
Therapeutic pipeline
LEAD PROGRAM
CDK4/6 Inhibitors
CDK4/6 Inhibitors
for Breast Cancer
Cyclin-dependent kinases 4 and 6 drive cell-cycle progression in hormone receptor-positive breast cancer. Our platform has designed and prioritized novel small molecules directed at this target.
COMPLETEComputational discovery
COMPLETEMolecules prioritized
IN PROGRESSIn vitro screening
COMPLEMENTARY DIAGNOSTIC PROGRAM
Assay development
Breast Cancer Diagnostics
Diagnostic applications
Human Infectious Diseases
Rapid pathogen identification for timely clinical decisions.
Antimicrobial Resistance
Early detection of resistance markers (e.g., Carbapenemases, ESBL).
Veterinary & Aquaculture
Field-ready molecular tools for animal health and rapid pond-side screening (e.g., WSSV in shrimp).
06 — DxBio · AMR initiative
Next-generation detection of antimicrobial resistance.
DxBio is our dedicated initiative addressing the global threat of AMR. By integrating CRISPR-based diagnostics, artificial intelligence, and microfluidics, DxBio aims to deliver fast, highly specific identification of priority pathogens.
Carbapenem-resistant EnterobacteralesPRIORITY
Candida aurisPRIORITY
Multidrug-resistant Pseudomonas aeruginosaPRIORITY
07 — Team
The people behind the helix.
Our team combines deep expertise across molecular biology, artificial intelligence, drug discovery, and diagnostics.
FOUNDERS & ADVISORY TEAM
Ravi LamFounder & CEO
Ravi Lam is a seasoned entrepreneur and technology leader dedicated to advancing healthcare through innovation. As Founder and CEO of Thinkhat, he leverages his expertise in enterprise technology and venture building to develop transformative solutions that improve healthcare accessibility and outcomes.
Prasad MaddelaDirector - Indian Operations
Prasad Maddela is an experienced operations and transformation leader with over two decades of expertise in scaling technology-driven organizations and building high-performing teams. As Director of Operations at Thinkhat, he drives operational excellence, strategic execution, and the development of innovative healthcare solutions.
Charles TimothyHR Global
Charles Timothy is an experienced HR and strategic leadership professional with expertise in workforce transformation, talent management, and organizational compliance. At Thinkhat, he drives people strategy, builds high-performing teams, and strengthens organizational capabilities to support sustainable growth and innovation.
Dr. Sam PerliAdvisorGene Editing & Biotechnology
Dr. Sam Perli is an interdisciplinary scientist and entrepreneur with expertise spanning molecular biology, computational science, CRISPR technologies, and AI-driven healthcare innovation. A contributor to research teams led by Nobel Laureates Shinya Yamanaka and Jennifer Doudna, he brings exceptional scientific vision and expertise in gene editing, RNA therapeutics, and next-generation biotechnology.
Phani KukutlaAdvisorLife Sciences & Biopharma Strategy
Phani Kukutla is a life sciences leader and venture builder with over 15 years of experience in drug discovery, development, cell and gene therapy, immuno-oncology, and biomarker research. With leadership experience at Pfizer and emerging biotech ventures, he brings deep expertise in translating scientific innovations into clinical and commercial success, guiding Thinkhat’s healthcare and life sciences initiatives.
Dr. Shiva Kumar AngalaAdvisorInfectious Diseases & Microbial Research
Dr. Shiva Kumar Angala is an accomplished research scientist with over a decade of expertise in microbial glycobiology, lipidomics, and advanced mass spectrometry, specializing in tuberculosis and infectious disease research. With extensive experience leading NIH/NIAID-funded research at Colorado State University, he brings valuable scientific expertise in biomarker discovery, antimicrobial target identification, and therapeutic development.
Dr. Krishna Rajendra Kumar PenmetchaSenior AdvisorRNA Therapeutics
Dr. Krishna Rajendra Kumar Penmetcha is a distinguished RNA biologist and life sciences expert with over 30 years of research experience in RNA therapeutics, molecular biology, and drug discovery. With more than 132 scientific publications, 20 patents, and experience in commercializing RNA-based diagnostics, he brings exceptional expertise in mRNA platform development, RNA-based therapeutics, and translational biotechnology.SCIENTIFIC TEAM
Dr. Karun KollaLead Scientist
Dr. Karun Kolla is a molecular biologist with over 18 years of research experience spanning molecular genetics, biochemistry, and translational life sciences. As Lead Scientist at Thinkhat, he drives scientific innovation in molecular diagnostics, AI-enabled drug discovery, and next-generation biotechnology solutions aimed at addressing critical healthcare challenges.
Dr. Siva ChirikiHead of AI
Dr. Siva Chiriki is an AI scientist with over 12 years of experience in machine learning, deep learning, and computational modelling, backed by a Ph.D. from IIT Indore. At Thinkhat, he contributes to advancing AI-driven drug discovery through intelligent molecular modelling, predictive analytics, and computational chemistry.
Sachin KarumanchiSenior AI Engineer
Sachin Karumanchi is an AI engineer specializing in Generative AI, Reinforcement Learning, and Explainable AI, with a B.Tech in Artificial Intelligence from IIT Hyderabad. His work focuses on developing advanced AI algorithms for cell-specific mRNA design, multi-objective optimization, and precision medicine, bridging artificial intelligence with cutting-edge biotechnology.
Abhijit GhoshResearch Associate
Abhijit Ghosh is a life sciences researcher with expertise in microbiology, biophysics, antimicrobial peptides, and infection biology. At Thinkhat, he contributes to molecular diagnostics and biotechnology research, bringing strong scientific insights into antimicrobial resistance and the development of innovative healthcare solutions.
Usharani EnthalaResearch Associate
Usharani Enthala is a biochemistry postgraduate with a strong foundation in biochemical techniques, laboratory research, and analytical problem-solving. As a Research Associate at Thinkhat Labs, she contributes to experimental research, assay development, and laboratory activities supporting innovative molecular diagnostic solutions.
Aiswarya CB NambiarResearch Associate
Aiswarya C. B. Nambiar is a molecular biology researcher with hands-on expertise in qPCR, ELISA, protein analysis, and biotechnology R&D. As a Research Associate at Thinkhat Labs, she applies her technical skills in molecular assay development, experimental validation, and advanced diagnostic research.Select a card to read the full profile.
08 — Partner with us
Let’s co-develop
what’s next.
We welcome conversations with pharmaceutical companies, research institutions, healthcare organizations, and investors. We actively seek partnerships to co-develop or out-license drug assets and deploy our diagnostic capabilities.
Pharmaceutical companiesResearch institutionsHealthcare organizationsInvestors
LAB
Thinkhat Labs, 6th Floor, Centre for DNA Fingerprinting and Diagnostics (CDFD), Survey Colony, Industrial Development Area, Uppal, Hyderabad, Telangana 500039, India
WEB
thinkhatlabs.bio